Microbial genome sequencing

Overview

Our service determines the genome sequences of microorganisms, including bacteria and fungi. You can choose between two sequencing methods: long-read sequencing and short-read sequencing.
・ Long-Read Sequencing
Recommended for constructing long contigs. This method requires high-molecular-weight DNA (>20 kb) and a larger quantity of genomic DNA compared to short-read sequencing.
・ Short-Read Sequencing
Ideal for creating draft genomes at a lower cost or for samples where obtaining large amounts of genomic DNA is challenging.

Workflow

Data Analysis

De Novo Assembly:
We assemble reads into contigs. Refer to FAQ section for details on the performance of assemblies using short-read and long-read sequencing.

Example of Delivered Data: Contig Sequences (FASTA format)

>scaffold1
TTATCAAGAATACTTCGGTTCAATAAAAATGAATCCTGTGGAACTACTCCTAAATTTTGA
TTGATTAATATTTACACCATCAAATAAAATTTTTCCTGTATCAATCTTATATAATCCTGA
…
>scaffold2
AACATTCTCTTCATTTTCAAGCCAGATATCATTTACTCTATTTAAGTATCCTGCTGCCAA
TAAATATTGAGATTTCTGAACTAAATAAAATTGATGCCATGGTTTGAAATGCGACAACCT
…
Base Correction Using Illumina Reads:
After assembling contigs with PacBio long-reads, we perform base correction using Illumina short-reads. Refer to FAQ section for details on the necessity of base correction.
Gene Region Prediction and Annotation:
We predict ORF regions from the assembled contig sequences and assign annotation information through homology searches against known gene databases.
Example of Delivered Data: Annotation Results (EXCEL format)
Position Strand Gene Name Gene Product Nucleotide Sequence Amino Acid Sequence
sequence01:218-1240 – pcpC choline-binding protein F ATGAAGCTTTTGAAAAA… MKLLKKMMQVALATFFFG…
sequence01:3331-3963 – rr03 DNA-binding response regulator ATGAAAATTTTACTAGT… MKILLVDDHEMVRLGLKS…
sequence01:3977-4972 – hk03 sensor histidine kinase ATGAAAAAACAAGCCTA… MKKQAYVIIALTSFLFVF…
sequence01:5744-6754 – fni isopentenyl-diphosphate delta-isomerase ATGACGACAAATCGTAA… MTTNRKDEHILYALEQKS…
sequence01:6738-7745 – mvaK2 phosphomevalonate kinase ATGATTGCTGTTAAAAC… MIAVKTCGKLYWAGEYAI…

Example of Delivered Data: DDBJ Submission File (Bacteria only)

sequence01 source 1..278302 mol_type genomic DNA
      organism Streptococcus pneumoniae
      submitter_seqid @@[entry]@@
      ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
  CDS complement(218..1240) product choline-binding protein F
      codon_start 1
      inference COORDINATES:ab initio prediction:MetaGeneAnnotator
      inference similar to AA sequence:RefSeq:WP_000771073.1
      gene pcpC
      locus_tag LOCUS_00010
      transl_table 11

Antimicrobial Resistance Gene Detection (Bacteria only):
We detect antimicrobial resistance genes within bacterial genomes.

Example of Delivered Data: Antimicrobial Resistance Gene Detection Results (EXCEL format)

Position Strand Gene Name Homology (%) Resistance
chromosome1:38381-39151 + ant(4′)-Ia 99.87 KANAMYCIN/TOBRAMYCIN
chromosome1:39368-39772 + bleO 100 BLEOMYCIN
chromosome1:44969-46975 – mecA 100 METHICILLIN
chromosome1:47075-48049 + mecR1 100 METHICILLIN
chromosome1:126289-127641 + tet(38) 100 TETRACYCLINE
chromosome1:2479070-2479489 + fosB-Saur 99.76 FOSFOMYCIN

Sample Requirements

Method Library Preparation Sample Type Total Amount Concentration Volume
Long-read sequencing – High molecular weight DNA ≥ 10 µg ≥ 50 ng/µL ≥ 30 µL
Short-read sequencing PCR-Plus DNA ≥ 500 ng ≥ 10 ng/µL ≥ 30 µL
PCR-Free ≥ 4 µg ≥ 50 ng/µL ≥ 30 µL

Frequently Asked Questions

Q: What are the differences in assembly results between long-read and short-read sequencing?
Short-read sequencing struggles with repeat regions, often resulting in fragmented contigs. Long-read sequencing can capture repeat regions, producing longer contigs during assembly.

Assembly Results

* The above are reference values based on our actual performance.
Organism Type Genome Size Number of Contigs
Long-read sequencing Short-read sequencing
Bacteria 1 – 10 Mb 1 – 5 30 – 300
Fungi 10 – 100 Mb 20 – 400 200 – 4,000
Q: Can complete bacterial genomes be generated using long-read sequencing?
Using PacBio reads, most bacterial genomes in our experience assemble into a single contig. However, genome structures or sample conditions may occasionally result in multiple contigs.
Q: Is base correction necessary after assembly with PacBio reads?
The contig sequences constructed from PacBio reads may contain systematic base calling errors, such as homopolymer misreads (e.g., AAAA misinterpreted as AAA). These insertions or deletions (InDels) can potentially impact gene prediction frames. To ensure accurate annotation, we recommend performing base corrections prior to annotation.
Q: How can fragmented contigs be scaffolded?
If a complete genome sequence of a closely related strain is available, it can serve as a reference for scaffolding contigs. However, differences in genome structure between the reference and sample may result in errors, so we recommend verifying sequences using capillary sequencing.

 

 

 

 

 

 

Back to "Products & Services"
Page Top